Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H003C11
Clone ID H003C11
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH003C11
Sequence
AAGTGTCATCCAACTCCCTAAGTGAGCCATTCTGCTTGAAAGGTCAAGATTTTTGTCCCTTTTTAGTAGTAAAACTGGTC
ATTATTTGTGATACAAGCTTAAAACAGCTCATAACCTGGATTATTTTTATTCATATAATTG
Sequence Type genomic DNA
Unitrap ID UNI24644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55969240..55969381 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022601 (Rpl24) NM_024218 ribosomal protein L24 Gene [Source:MGI (curated);Acc:Rpl24-005]


SPLK-Sequence tag 3SH003C11
Sequence
GCACACCTCTAGTCCCAGCAGTTGGGGGCAGCANGAGCAGGCCNNATCTACANNGANNCAGGACTATAAAAGAGAAAACC
TGTCCCAGAACGCCTCCCGCTCAATAAAGTTCTTTGACTTTAATTTTTACTTCATTGAGTAAGGTTAATAAAATCATAGT
CTTTGCTTTGTAGGAAGAAATTCAAAAGAAAAGAACCCGCCGTGCAGTCAAATTCCAACGAGCCATCACTGGTGCATCTC
TTGCTGATATAATGGCCAAGAGGAATCAGAAACCAGAGGTTAGGAAAGCCCAGCGANNGGAGGCTATCAGGTAAGGATTG
CTCTACCGTCAGCTTTTCAGCTGTGGGTCAGCCTTTACAGAAACCCAGTCTCATCATGGCACTGTTGGTAGAAGCATAAT
ACAAGCATATACTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022601


For any suggestions or comments, please send an email to unitrap@crg.es