Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H003A06
Clone ID H003A06
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H003A06
Sequence
TCTTTTCTCGTGACGGTGGAGTCCGTGCANNGTCGCCCATACTCCGAGCAAAGAACTGTGCCAGAGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SH003A06
Sequence
GACCCCTTGGCTTTTGGTGCTAAGTTCATGAAACACCCTCCACCCCACCCTTGCACGCGCGCGCG
Sequence Type genomic DNA
Unitrap ID UNI10491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98625597..98625661 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es