Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H002E05
Clone ID H002E05
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H002E05
Sequence
TCTTTCGGGATGGAGTAAACTGGGGTCGCATCGTGGCCTTTTTCNNNTTTGGCGGGGCTCTGTGCGTGGAAAGCGTAGAC
AAGGAGATGCAGGTATTGGTGAGTCGGATTGCAAGTTGGATGTCCACCTATCTGAATGNNCACCTAGAGCCTTGGATCCA
GGAGAACGGCGGCTGG
Sequence Type mRNA
Unitrap ID UNI3494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152655163..152655338 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


SPLK-Sequence tag 5SH002E05
Sequence
CCTGTCCAGACCCCTCCCCCAGGTGCCTGTTCCTGGGCGTGGAGCTTGATCCCTGCCAAACCAGCTGGAGCCAGGAACTC
CCCCTGTGGCCCNNCTGNNGCCCTCCTGTCTTTTTGGCGGAGAAACTAGCTTACCCCTTCAGGTANCCCACATGTAGTTG
TTCATGGTCTCAGTTCTTCCTTGCAGTGTTTGCTGTAGTGGCCCTGTACACTCTGAATTGTTTTGTAAAATTAATTTATT
GCAAATACAACAGAGAATTGCTTGG
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152630022..152630286 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


SPLK-Sequence tag 3SH002E05
Sequence
CTGCCCTTCTTCTCTCGCCCCCTTCACACNNNNANAAATAGAAATAAAAAGCCAATTCCTACCATCAGGAGTACCATANN
NGNCTTTTGCACTCTTCCCCCTGTCAGTCACCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es