Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001H11
Clone ID H001H11
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH001H11
Sequence
GATCCTCCTGCCAAGGATTCTAGGCATACACTACCATACCTGGCTAAAAGAG
Sequence Type genomic DNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101409683..101409734 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]


SPLK-Sequence tag 3SH001H11
Sequence
ATTCTTTTTGCTTGGAAGTAGAGAAACTTGGTGAATAGCTTTAGGCTCCAAGTTCAGTTTTCAGCCCCAAAGATAGATGA
TAAAGAAATGGATACTCGGGGAAAATGAATCCTCTGGCATAAGGAATGTTAAAAATCCTAAGCAAGGGCTGGAGAA
Sequence Type genomic DNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101409162..101409317 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es