Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001E12
Clone ID H001E12
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH001E12
Sequence
TCCATAATTTTGGATGACCAAGGAAGAGCACATGACTATTTTCATATGTTGCTCCTACCTGAGAGTGCAAAATGCTAAAA
TACTTTTTATCTCCTAGGGTTACAGGTTCATCTAAAGAGGATCTTGTTCCATCTACTTCAGTTGGCTATACGGGTAGTTT
TCTCTTAAAA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30065503..30065671 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SH001E12
Sequence
TAAAGACCTTTTCAGGCATTGTGAATAAATGCCATTGATTCTGGCTTCAACTGCTTAAGGGGGGATGTATTAAATAATAG
TATTAAATGCTAGGGTCTTCAGAAAGGTTCCTTTATGAAACACGTGATTTTTGTCCCCTGTAAAATTTTGTATTTTGGGG
GGAAAGGGGATGATATTGAACCTGAAAAAAGTTGCATGTGAGGTATAG
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30065692..30065898 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es