Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001E03
Clone ID H001E03
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H001E03
Sequence
CAAAAGCCTTAATTTTCTTTCTTGTTCGGTGCCTTCCTNNAGGCNNCAAAAACAATTATTTCAGTAAACCGTACACATGA
GGGAAATCGTGCCCATCCAAGTCGGGCAGTGTGGCAGCCAGATCGGTCTTAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SH001E03
Sequence
TTTCCACACTTTTAAGTATCTATTACCCCTCTGCATGGTTCCCATTTTTTTTTCCCTAGACTCACACCCTAAGGAACTAA
AGATTAGCTCTACTGCCACCAGGTGGTAGTGCCTGGAATGACAACTTTAGGGCTTTGTGGCTGATCTCCCACCCAGAGGA
AATGCATTGCTGATCCGTCAAACATTGACTTGAATTCCTGCAGGTGGCAAGGATGTCCCTCGAGCTATCTTGG
Sequence Type genomic DNA
Unitrap ID UNI24520

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35973189..35973421 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001525 (Tubb5) NM_011655 tubulin, beta 5 Gene [Source:MGI (curated);Acc:Tubb5-001]

 
Come back to gene ENSMUSG00000001525


For any suggestions or comments, please send an email to unitrap@crg.es