Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001C07
Clone ID H001C07
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH001C07
Sequence
ACTTGTCCTATTTTAAAATTACATAACCTTTCCACTGAGGACTGTACCATTGTTTCCAGCTCTATTAAAGACAGGGCAAG
TCGACCT
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22744887..22744973 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]


SPLK-Sequence tag 3SH001C07
Sequence
TAGCTCTGTGATTAATTTTATTTAAATGATAAATTTCATTTGAGAAAAAGAACCATAATGGGTTGTAGAGGAGGAAAAGG
TGAAGATCAGAGCATGTCCTTCCAGACACTTTGATCTATACTTCTGCCTGTCAGGACATGTGGCTGAATAAAATATTTAG
AAACACTTTTTCCTATTNNATTGTTATCATAGAGGGGCGAACACTATCCTGTAGCAGCTAGAGACCCAGTTCCTTAGACT
CCGCCTGTAGTTCTTTTGCGGCTTGCAGACAGAAGACCCTGGCAGACAGGCTTTCCTAACCCGGCGCCNNGNGCACTCCT
GGGGCTCTCCTGCCTCACTGTCAATACCTAGCCAGCCCTCTTGCACTAATTAGCTCAGAAGTCTAGGAATGGCCGAGGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es