Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001A12
Clone ID H001A12
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH001A12
Sequence
GATCTAATTCTCTTCTCTAGTTTAATGAAGGAAGCTTTAAAGGAAGTGTTTGATTTTGACCAAATATGCTATATTGTGAA
AGTTAGCAGGAATACTGCAAGGCTCATTTGGTTATTAGAAGTTGTCAAGACTTGTGTACTAGTTAGCTGTGTCTGTGAGA
GTGGATAGAAGCAGAGATAC
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70324630..70324809 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


SPLK-Sequence tag 3SH001A12
Sequence
CCACTACACAGGAGAGTCTGAAGGCGGTCCTTCTGCACCCACAGCCCCNNNNCCGGGGGGGGGNNNTCCCTGCANNNGGG
GAGATGATTAATAGCAAANNGGGGAATGAATTCTCTCATCTGTGTGATGATTCTCAAANANNNGANNNNNNAATTACTGG
CAACCAGCAAGAACCAGAAAAAAGGGGGGGTTGTGAGAAAANNNNCCAAAAACCAGCGGGCTGGCCCCTCATATGTGCAG
AACTGTGTCAAAGAAAATCAGGGAATCCCTAGGGCNNCAGACAACAGCTAGAGACACCCGGTGGATGGGGATAAATGACT
CTTTCNTNAAGTGAGGGGCTGGTCTTCTCCCTCAACTAGGCTCCAATTTTGGGGGCTCTGATACAGTGACTT
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70323997..70324380 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es