Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H001A09
Clone ID H001A09
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 3SH001A09
Sequence
AAAGTTGTACATGTTTAATTGAAAACAGAAAACCAGCATAGGAAAGGGGTTATAAGTACATGATTTNNGGGAACAGGTTC
TTGTTCATGTTAGTCTCGTGGTTTACGTATGGATTTGCATATATCTCAAAGGCTGCTCCTTTTGTGGTAAAGCTCTAATT
GGTCATCAGTCTCATTACGTTAAGAGTACCTGCTCTAATTAATATGTCTTATAGTTTTTGGGTGTGAGCAGCCTTTAATG
GCTGAGCCATCTCTCCAGCTCTCTAATGTGTCTCTTAAAGAGGTACACATCACGCCATTCATCTACAGATGTGTAAGGTA
AATATTTCAAAACAAAACTTTCATTAAAAGTGTTATAATGCTGAGGTAGAGAGTATAATTCTGTNNTCTAAATGGCCTAT
GAACTCAGGCATCCATGGTGCTTCTGAGTAAGTAGAAATGAAGGCAGTTGCTGCTTTTCAGGGTTGGAGGATCTGAATGA
TGACCCTGACCTTGTGAAGGCGGTGGAATCACTAACATGTGGGAAG
Sequence Type genomic DNA
Unitrap ID UNI29560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46025477..46026002 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035517 (Tdrd7) NM_146142 tudor domain containing 7 Gene [Source:MGI (curated);Acc:Tdrd7-001]

 
Come back to gene ENSMUSG00000035517


For any suggestions or comments, please send an email to unitrap@crg.es