Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST035
Clone ID PST035
Vector pGT1TMpf
Project baygenomics

Sequence tag PST035
Sequence
CTTTGCCAGGAGCTGGAGCCTGAGTCCTGCAGTCCCGGCTTCAGTTCCGAGGTCTACACCTTCCCGGTGCCGGAGAGGCA
CCTGGAGAGAGGCCATGTCCTGGGCAGAG
Sequence Type mRNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109128199..109128307 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es