Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E326H11
Clone ID E326H11
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE326H11
Sequence
TCGTTGGGCTAGATGCAGCGACTTTGTCCTAAGGTAGAGATTTGTCCCTAAACTTAACTAGGGAATCTAAATGTGGAAAG
GGCTTGCTCCTTACTTGGTGTGTCTGGCTGGTGACCTTGAATGAATAGGAAGTCTTTTATACCTTTGGCTTCGTNTTGCT
GACTGTGGCTCGTATCGCCACTAGTGGGATAGGTAACGGAATGTTTTAAAGATAAGAGATCAAGACCATAGCCAGGTGTG
GTGGCCCCCTTCTGTTAATTCCTGCACTCTAAGGTTGCAATCTTATATTAAAAGTAAATTACATTTAAAAGTAGCCTTTT
TAAGTGTTGAGTAGTTTTTCTGTGTCTAAAAGCAGTCCACACTAAGAGGGTAAATTAGGCAGGCCCTTTTAACCCTGTTA
ATGTAAAGTTCGCTGCACTGTTAGCCAAAGTATTTCAATTGATTTTCTACCACACTTGAGGTTTATTGGTATCTTTAGTT
ACTAAAGAATAATGTTTTTAACAAAACATGAGCCATAATTAAGCTGTTCAATAATCTTTGGGGACTTTCTCCAGAGAGAT
ACTAGTGGCATTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE326H11
Sequence
CCCATCGGTAAGAGGAAAATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTTATTGGTGGGCTTAATACAGAGACGAATGA
GAAAGCCCTTGAGGCAGTGTTTGGCAAATATGGACGAATAGTGGAAGGTGAGTTATCTAAAATCGTATG
Sequence Type genomic DNA
Unitrap ID UNI29561

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54644722..54644872 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031134 (Rbmx) NM_011252 RNA binding motif protein, X chromosome Gene [Source:MGI (curated);Acc:Rbmx-004]

 
Come back to gene ENSMUSG00000031134


For any suggestions or comments, please send an email to unitrap@crg.es