Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E326F05
Clone ID E326F05
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE326F05
Sequence
AGTTCCCTGGGGAGTGCACGGGATGGCAGTCTGTGACATCTGTGACAACCAATACCACAGTGCATTTGTCCCTTTAATGT
TGGGGTGGCAAAAGGAAGCCATTTGTAGGTGCCTCAATAAAGAGGCAAAGGGGGAGGATGACACAAAGGCCTGATGGGGA
GGGTGACCCTTGTGCTCAGGCTTGGAGTTAGAATAGGGTTTTGAACAGCAGGCATGGGTGGAAGGCTGCTCTGGACAGAT
CGCAGCTTCATG
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202939..157203190 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]


SPLK-Sequence tag 3SE326F05
Sequence
TTGGAGAGCCATAGGCAGTTCTTCCAGCGTCACCAGGGTCTTAAGAGTGGAAGAGGAT
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157203206..157203263 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es