Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E326F03
Clone ID E326F03
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE326F03
Sequence
ATTACCGCCAAAAATTACCAGGTTTTTGAGGTGTTCAGAAGGTGACGAGAACATGAACGCTTAAACTAGACACTTTAGGG
TTCTATGTGGTGTGCACCCCTCCTTCCTACAGAAGGGTCGTGACCCCAGAAGGAGTCCATCCTGCCACCAGGCCTCAGCA
AGCTTTTGTTGACCTTGCTGAGACCTGAGCAGCTCTCAGGAAGAGGGAGATGGACCAGCAGCCACCCACAGGGTCACACC
CCAGGCCTGAGGGACACTATGCAGGCAGAGGGCAGCCATGCCAGAGAGCGGTGGCCTGACACTTGTCATTTGCAGCCACA
GTGTTGGTGGGATGATGTG
Sequence Type genomic DNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142923327..142923665 327
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es