Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E326D12
Clone ID E326D12
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE326D12
Sequence
GAGCCTGGCTTTTCAAATCTCTGTAGTTCTAATTAAACTAGCACACAATTATATGAGAGCAAGTTTCTGTGTAAGTGGTT
TCATTATTTTTTATTGACGCTAATCACTATGGGGTGGTTCAACGTTGCAGTGGATTCATTACAATAGAGGAAATCTTAGA
ATCTGCTACATTTATGTTTTATTCCCGCAGTAGTGAACATCGGGAAGAAGCTCTACGAGGGTAAAACAAAAGAAGTCTAT
GAGTTGTTAGACACCCCAGGCAGAGTCCTCCTGCAGTCCAAGGACCAGATCACAGCAGGGAATGCAGCTAGGAAGAACCA
CCTGGAAGGCAAAGCCGCCATCTCCAACAAGATCACCAGCTGCATATTTCAGTTGTTACAGGAAGCTGGTGAGTGCTTCC
CTTTGCCCTTCACAGGGGTCATTTTCCAGGGGAGAAGTTGTTTCGATCAAGAATGCAGTATACATCTCATGTGTTACTAC
ATCTAAAGCAGGTAACTGACTCTGGGAGAGAGATGGCTGTGTTTGACTTAACCTATAGGGAATGTCTCACAGGCTAATTT
GCATNNNANNNAATGAAGAGAGGAGCTTTTAAGGTTCACTCTAACAGTTTCCTGGTTTGAAAGTAATGCTGTCCAAATTC
CAAAGACCCTTAAGCTAAGGATAGCCCAGTGATAAAGTACTTATGTGGCCTACATAAAACCTGAGGTTCAGTGTTCAATG
TGGCCCATCATTTTAGTTACTTT
Sequence Type genomic DNA
Unitrap ID UNI14346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77385381..77386123 729
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es