Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E326C08
Clone ID E326C08
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE326C08
Sequence
GATCCAGCTTTGAGGCACTTGCATACAGAACACAGTGTTCGGTTTCTCTAAAGTCAGGCTAATTGAATGGGATATGGAGG
TTCTAGCTGAGGAGAATAATAGTGATTCTTTGACAGTTATACATTTCCTCTAGAGGATATAAGGCATTGTTGGGTGACAG
GGAAGTGCAAATCCAACTTACAAAATGAAATGTGCAGGCTACTCATCCTGCCCAGCCTACCAGTTGTTCACGACATTTCT
CAGTGTTCTGCCATTAATGGTTATGATTTTCTCTACACATTTGGCAGCTCATCTCCTTTTCACAGTAGGTTACCAGTATG
GTAAGGATGTGTCATCATAGAGAAAAGGCAGCTGTTTGGCATTGTGTTTTTGTGGAAAGGTAGGAAACGTAGGTGCTGTT
ACTTTCTCTGTACACAGTTTTCAGAATGTTACTGTCAGAGAGGGACATAAAGGAAGAGCATGAGCTTGATTTGTTTCTGT
CTCTCTCTTCCACTCTCCCGACCTAGGGCGTCTTTTACACAATCACATCTTTTGCAGATAGGGTTTTGTTATGTGAATCA
CTTAGAG
Sequence Type genomic DNA
Unitrap ID UNI29565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57846823..57847389 567
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019920 (Lims1) NM_026148 LIM and senescent cell antigen-like domains 1 Gene [Source:MGI (curated);Acc:Lims1-001]


SPLK-Sequence tag 3SE326C08
Sequence
GAGTGGTCTCTCTATTCTGCTGACTCCAGATAGGAGTTCTTGCCGTACCTGATAGACTGAGATTTGAATTATTGGTTATG
GGACAAAGTATCTACTATTGTACTTCCTGACNAGATTCTCAGCCTATGGACGTATGAAGTCACACTCACTTCCTTTATGC
AAAATCTCCTCACATATCATAAGCCCAGCCCCGTGCTACTATATAACTACGACTTCTGAGCTACCTCCTTTATTTTACAT
GTTTTATTTCAGTGCTCCACTCTTAGGCTCAGCTACATGCAAATAGCCTTATACCAGGCATCCTGGCATGGGGCATTGGT
GGTGCAGGGATGAAAACTGGTACTTTAATCCACACATTTCATATTTTCATGTTTTTAAATGATTTTTTAAACTTTCTCTC
TGGGTTATAGTTAATATACAANNNAGTTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019920


For any suggestions or comments, please send an email to unitrap@crg.es