Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E326A02
Clone ID E326A02
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE326A02
Sequence
GATCTGTGGTGGGCTCCCTTTAACAATCTCTTTATCAGTGTGTTTGTCGCTGTTTGTGTTTGTTTG
Sequence Type genomic DNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75500119..75500184 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]


SPLK-Sequence tag 3SE326A02
Sequence
GATCATCTATCTNNNAGGCTGCTTNNCTAGGTGATGCTGAGTGAGAGCCTTGAGTTGGGCTAGCCAACAGCTTGTCGATG
CACCTTCTGCCCAGGTCTGGACCTTGAAGGTTGGTGAAGAATGGAAGTGGCACTGGCTGGATGTCCTTAATGTGTATAAC
CACCTCAAAGTCTTTGATGAGAAAACTAAGTCCCTTTCCCGTGCTGACTGGCGTGTGATTTGTTTGTACTCAGGTGGCAG
TGTGTGTGCAGTGCCGTGTGGCCACACTCATCAGGAGCCACATCAGAAATGGAGCAGCCATTCACGGTAGATGANNNAAG
ACGAACAAG
Sequence Type genomic DNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75500746..75501073 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es