Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E325G04
Clone ID E325G04
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE325G04
Sequence
TGGCAACAACAAAATAAAGAGAACCGCTTCTAGACAGAGGTCAAAATGAGTTCATTTTCTTAGGGGCCTGTTTTTGTGTC
AGTGGGTTTATTAC
Sequence Type genomic DNA
Unitrap ID UNI27250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81037412..81037505 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]


SPLK-Sequence tag 3SE325G04
Sequence
TAAAGGTAAAGGAAACAACTATTGAGCTTTATAAAGGTCTGG
Sequence Type genomic DNA
Unitrap ID UNI27250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81037520..81037562 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es