Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E325E12
Clone ID E325E12
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE325E12
Sequence
GTCTTACAAGTCCCTTGGAGCTGTTTGTTTCTCTTAGCACCTTTTGTAGTTTCCCAGTGTATAGAGTTTGCAGAGTACAA
ATGAGCTGATTGGTGGGTACCTCAGGCACAGGAGTTAGAGTCATGTTA
Sequence Type genomic DNA
Unitrap ID UNI11186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88798787..88798915 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]


SPLK-Sequence tag 3SE325E12
Sequence
GCAAATAGATTGCAGAGCAGTGAGGGTGTTGAAATTTTTGATGCTGTCAGGAACCTAGAAGGCTGCAGAGACAATCAAGC
CTCACCGGANNACTCTGTGGTGTGTCAGGTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es