Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E325E06
Clone ID E325E06
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE325E06
Sequence
GCCACATTGTTGACCAGACTTACAAATGAGCCTTAGGCCCAGAGGTGGTTGCTCCACGCAGGTCGCTGGTGGTGCTCCTG
GGTGCCCAGGTTTTAAGAGTTGGGAGATGCTCCAATNNCTTAAGACGTCTTCAGGTCGGTCCCT
Sequence Type genomic DNA
Unitrap ID UNI22279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119317911..119318054 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061393 (Acvr2b) NM_007397 activin receptor IIB Gene [Source:MGI Symbol;Acc:MGI:87912]


SPLK-Sequence tag 3SE325E06
Sequence
ACNGTNNGGATTGTAAATCTCTAGATCAGTCACAATGGGATTGTTCCACGCAGNNNNGGAGCCTTCGTCCTGACATGGGA
CTGACTAGACCTGGCTTCTGGCCTTGGACAAATCNNATTCTTTTCCCATCAAGCTATGCACACACATGTGNNATCTTTCC
AGACCCTCTTGTGGCCTNNAAGCNNGCCCAGCTGTTTTCATTCAAGGATACGTGATTTTAAAGAGAAATCCNNTGCCGGT
GANNTGAGCNNGAGCCCACATCCTTAAGGAATGTTCTGCAGGTNNCTGAAATGCTGGACAATGTTGATTCTTCTCCCTGC
TTAGTTTCTGGACTACAGCTGAGGAGTTTGGAGAGGCAAAGCCAATGCTCTTGTTTGTAGACGTGTTCAGTAGGCAGACT
ATTTCGGTTCTACCTCTGAGAACCAAGTAGGCTAAAATTAGATCTGGGGAGAAAAAGGAAGACTGTCGGAAACTCAAGCC
CTTGGCTGGAAGNNGGAGGAGGCTGTTTCCCCATGTTTGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061393


For any suggestions or comments, please send an email to unitrap@crg.es