Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E325D02
Clone ID E325D02
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE325D02
Sequence
GGATCTCAAATGCTCCGCCCTTCATGGTAACTGGACCTCAGTCTTGTTCAGAAATCGTGGGTTTTCACCCTCTGGCTGGC
TGTCCCCTTGTGTTTGTGATGCTGTTTAAACTAACTTCTCTCCCTCCTCCCCCTCCCCCTTTTTCTGTTGTTTCTTCCAG
AGCCTCACTTGTTCCCTCTGGTTTTCTTTTTTTCCCCTGTGAGGGTCTGAATGGACAGGACAGAGTTGTTGAATAAGCGT
GTAGCTGCTCCATCTCCACCTAGCCGGCCTTTGATAGGTGCCTGTGTGTGCTGCCTACCCTCTCGAAGACCTTGTCTTAG
AGGAGGTCCTGAGTTAAAGAATTTTAAGGTTAGGTTAACATGGGAGAGTTACAGCGAATCTAAACGTCTGCCTTAACTTT
CTAAACGTGGGCATTGATGTGAAAAGAGTACAAGTCACTTGTCAGTTCTGCTCATTTGGTAAGGTTTGGTGTTCTCCTTT
AGTCTCATTCACACTTCTGAGGTAAATTTGAGGATACTAATTAGTGTGAAGGTGGGAAATTTACCAGCCCTTTCAGCCTG
CCCCATGTATAGAGAATGTAATGTTTTCTAGATCAAGGAAGGAACATTTCTAGTC
Sequence Type genomic DNA
Unitrap ID UNI29574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46088611..46089225 609
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

 
Come back to gene ENSMUSG00000070047


For any suggestions or comments, please send an email to unitrap@crg.es