Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E325C01
Clone ID E325C01
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 3SE325C01
Sequence
TAGCATACGTAAACACTTGGCCTCAGCCAAAATCACCGATGCCTTTTGGTGAGAGGGGCCTTGGAATGATACCCAGGACC
TAGTGCACGCTGAGCACCTGCTCGGCCATGGAGCTGCATGAAGCACTTTCTGTTCACTGAAGTGCAGTGTCAGGTCCCTG
CAGGGCTGATGGTAGTGGTCTCTCAGCTGACTCAGCTTGGCTTTGATTGTAAAATGCCTGAAACCCTCCCCGAGTAAGTA
AAAAACACACAAGACCTGCTAAACCTGCCTCTGGCTTCCTCTTTTCAGCTGACCATGTTCTGGGTCATCCCAGTGGCCCT
AAAGTTCACAGAATGCAGTTATCAATACTAACAG
Sequence Type genomic DNA
Unitrap ID UNI10574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88795053..88795406 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es