Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324H07
Clone ID E324H07
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE324H07
Sequence
GATCTGGGGCAGTAAGCTGCCGCTCCCCAGAGCCTAACAGCGTGCAGAGTGTGACTTT
Sequence Type genomic DNA
Unitrap ID UNI29579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46057451..46057508 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]


SPLK-Sequence tag 3SE324H07
Sequence
CCGTGTGTCTTCGGTTACCTGGCATGTATGCATTCTAGGAAATGGAGTTCCTAGGTCAGTAGGTTAAGGTGGGGGGTGGG
GGTGGGGTAAAACAGATTGCCACATTTCTGGATGGAAACAGTAACACACCTGCAGCTTACTGGGTCTTGGCTGTCTTGCT
GCTGCCTTTGAGTCATTTAGACTTCATGAAATCAAACCGGTACCAGTTGGCCAGAGGCACCGTTTAGCGTGGAAACAGCC
GATGTTGATCGCGGGGCTCAGGTTCTGGCTTTGTTTGGAAATCTAGTGTGTTTTTAATAAGCCAAACTTTGGGACAGTAC
TCTGGTTTAACTTGGA
Sequence Type genomic DNA
Unitrap ID UNI29579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46057533..46057868 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

 
Come back to gene ENSMUSG00000070047


For any suggestions or comments, please send an email to unitrap@crg.es