Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324E06
Clone ID E324E06
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE324E06
Sequence
TTTTAATAAAAAGGACAGATTGGAACCTGCAGAGGGGTGGACAGAAGTGAGTGTTTGTCCTTCGTGTATTTCAGGTGACT
GATCTGTCCCACCTTCTGTGGCTTCCTCCCTGTGTTCTAGTGCCTGGTTTGTTTGACATGTAAAGCTGGCCACCGCAGAA
TAACAGTTCCCCAAATGACAACATCAGTTTNNCGATGATATAGTTAGGCAGCGGCGATGTAGAGAACTTTGAGGGGCTTC
TTGGCCGCACAGTTTTTTCAGTGCCCTTGTG
Sequence Type genomic DNA
Unitrap ID UNI9030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40771580..40771850 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]


SPLK-Sequence tag 3SE324E06
Sequence
AATCTGCGCGGCTCCCATCCTGACTTGTCCTGAGCATAGTTTTTCTACGGAGCATCTTGCTGGGACTCATGTTTCTGGAA
CCTATATTGAAGATGTCCAGGGAGCATAGAGTATTGTGAGCCTGGGCTTGCAATCTTGGGTCTCTGCTTGCATCAGTTTG
TGAATACGACAGAATCTGTTGTTCCTGATGCCTTTGAGCATGTCACATTCTGATGGCCCTGATTCTCTGAATTCATCTAC
TTGCATAGTGACTCAGTTCTCAGACTACTTCCTCTTGAAACGGATATCTGAATGCATCCTATCTCCAAGTCATATTTTTC
CTTTATAGACCACTATATCGAAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es