Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324D10
Clone ID E324D10
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE324D10
Sequence
TTAAAATATATCATTGACATCTAGAGCACGTACAGCCTCGTATAGTTCTAGAAGGTTTCCATCACTCTAGAGATGAAGCC
CTTTCGGTTCTTTGGAGAACTCTCTTAGCTCAGCCCACCTGCCTGCCCCTCCCCCGCCGTTTCCATCTGATCCGCCCCTG
GCTACTCACTAGCCCCTTGCTGCTCACTGGCATGGAGTCTGAGG
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106571237..106571440 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


SPLK-Sequence tag 3SE324D10
Sequence
TTTTCTAGACTCCGGTAACTTCTGGCATTACCATCCTGACCCACCTGACCCCTTCTCTCCCACACTCCGCTCCTGAAACT
GGCCACGCCAAGAGTGCACAGGTGTTTTATGCTCCTGTTCCTGATACACGCTGTTCTGTGTTCTGGAGTACCCAACAGCT
GGCCTGCCGCTNNCCCAGTGGACTCG
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106571040..106571226 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es