Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324D03
Clone ID E324D03
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE324D03
Sequence
GATGATCTCTCTGAATAGTGTTTTTTCTTTCCCCAGCCCTAATTTCTCCATTTAGAGTAACTTCTGGAATCGTTTGGATT
GAATTATTTAAACAGTGATTTCGATAGGAAAGCTTTCTATATTTAATTTTTTCCCC
Sequence Type genomic DNA
Unitrap ID UNI27250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81034587..81034722 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]


SPLK-Sequence tag 3SE324D03
Sequence
TTGCTGATGGTGAAACAGTTCACTAGAGTTTCTTGTTCTGGCAGATACAAGATGGACTCTGTGAGCTCAGTTGTTCCCTT
GGATTCTGCTTATTGAACTTTTTTACACTATTGTGTCTTAGAAATACTGTTTCATTTTCCAACAATCCTTATGGTAGTAT
TATAGGC
Sequence Type genomic DNA
Unitrap ID UNI27250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81035068..81035234 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es