Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324C10
Clone ID E324C10
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 3SE324C10
Sequence
TTTCTTTCTAGACTTTTTGTTGTTGTTGTTAAGAGTATTGAAGCCCTCAGGATTTAAAAGTAATTTCTATTTCTGGCCTC
TCAGAGTGTTTCAAGTCTGCTGAGGTAGTTCCCCTGCCCATAAGGACATGACGTCATTGTATAACTTTTACCCAAGTTAA
AAGATAAGAAGGAAAAAACCCCTAAACATCCATCTACATAAACAATGCTTAAATCTTTGATTAGCTAGTTTCCACATCTG
AACTTTAGTGGAATATTGCTTTTAAGAGTTTTTTTGTTTGTGCAGGCTCACCAAGTCAGTTGGCAAAATTCAGTAGTTTT
GTAGGGGAAAAAAGAGAGGGAGGGATGGAACTGTTAATAACTTTCCCCATCAATTCTTCGCAGCTGGCTGTTTTGACAAT
GGGAAGCACTATCAGATAAATCAGCAGTGGGAACGGACCTACCTAGGCAACGCCCTGGTTTGTACCTGCTATGGAGGAAG
CCGGGGTTTTAACTGCGAGAGCAAGCCTGAGCGTAAGTGGAAGGCAGTCTGGGCCCTGGCAGAGATGATGCTCTAAGTAA
AACCACATTTGCCTTCTCCTCCTCCCTGCTCCAGTCGCTTGTAATTCCCTCTTATTAGACTTCTTGCACTGGCTTTTCAC
ATGCTCTTACCTCTAANACAAATGTAATCCACACGAGTCTCCAAAGCCGCCTTT
Sequence Type genomic DNA
Unitrap ID UNI29586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71697913..71698606 688
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es