Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324A06
Clone ID E324A06
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE324A06
Sequence
GATCCTGTGACTTGGAGAGGTCAGATGCACAGGCCAGTCTCAAGGCCNNCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE324A06
Sequence
ACGGGAGGCACAGGGAGTCTTGCACAAGGGCCAGCTCCCCTGCCCCCGCTGGGATGCTGATACATTTTTAATGCCCCAGC
AATGCTGAGAAACAGAGCAGGAAGGGAGGAGGAGATGGACCAGGAGAGATGGCCCGGCAGTAAGAAAGTATGTCAGGAGC
CTTGGAGAGGTGTGAGTGCTGGATGCCTAGAGACATGGAGACCCCAGGGTCACAGAAACAGAAACCTAAGACAGGGATGA
ACACCTGTGACTCCAGCACTCAAAGAAGGCCGAGGAGGGC
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20331708..20331987 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es