Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E324A03
Clone ID E324A03
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 3SE324A03
Sequence
AGGAATGAGCAGAGCTCAACTCACGACTTAGATGTGTCAGCATCTTAATGTGCTAATTGCATATTTTCTATTAGCGGTAT
AACCTATTGAGTATCCTTCTTATTAGATGATGATGATGCACAATGCATACCTAAAAGAATTAAATTATCTGCCCTTGGTA
AATAAATCGTGATTGGGTTCATGTTTTAATCTAGATTTATTGAGTTTCAAATCTGTGGTCTCTTTTTTTCTGTATCAAGA
GGGCTCTGTGAG
Sequence Type genomic DNA
Unitrap ID UNI9822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 97888516..97888768 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027878 (Notch2) NP_035058 Notch gene homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97364]

 
Come back to gene ENSMUSG00000027878


For any suggestions or comments, please send an email to unitrap@crg.es