Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E323H01
Clone ID E323H01
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE323H01
Sequence
GGTAAGCTCGTGCTGCCTCCCCATTGAGTTGTGTGAGGTACACGGCCACAAAAGTAAACATTACAGGCTATTTTTATTTA
AGGTAAGCAGCTCTCTGGGCGCCCATTGAGTCCTTAGGCGAGCCAGCTGACCACTCTTGTTCCACTACTAGCATGTCTTT
CTTTATTTGGGTAAGCTGTCAGAAAACTCACATTTCAGTAGCAAAGTCAGTTTTCTCAAAGACTCAAGTTTCCTGTCCAC
ACGGACTTATAAATCAAGGTATGTAGGATTTAATAAACTAG
Sequence Type genomic DNA
Unitrap ID UNI29579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46048873..46049153 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]


SPLK-Sequence tag 3SE323H01
Sequence
ACCACGAAAGTATTCTTCTGAGAGGCATATAGTTCATTATGAAAGAGGACAAACACCTTTGGTGGAAGATGAAGTCAGGT
TACCAGTGACTAGACATCTGATCTGTGGCTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000070047


For any suggestions or comments, please send an email to unitrap@crg.es