Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E323G11
Clone ID E323G11
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE323G11
Sequence
AAAACGCAAAGTGACCCCCATCAGATACCAGCTCTTGGGTCTATTGACCAGCCAATATCCATTGATAGTGGAGTTCTACA
TCCATATGGAAGATACTCCATTCTCTTTCATGGACAGGAGTGCCAAATCAGAATACAGGACATTACA
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109139020..109139166 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


SPLK-Sequence tag 3SE323G11
Sequence
TTGTTGTGAAATAGCTCAGTATTAGAGTCCTTGTCTAAGATATATGGGCTCCAGGCTTGCCCATCCATCTA
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109139348..109139418 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es