Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E323F06
Clone ID E323F06
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE323F06
Sequence
GATCTTGGATGCTGTGCCTCTGCTCCAGGCGATGGGTGTCACTGAGCCGGCTTAGGGATGCCATTCTGCTGAGCAAGGGG
TGAGGTGGCTCAGAGGGGCACCTGGGAAAGA
Sequence Type genomic DNA
Unitrap ID UNI29183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103082155..103082265 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032549 (Rab6b) NM_173781 RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

 
Come back to gene ENSMUSG00000032549


For any suggestions or comments, please send an email to unitrap@crg.es