Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E323E05
Clone ID E323E05
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE323E05
Sequence
GATCTTTAAATTATGAAGTGCAATCAGTAACACACCTGTAATTATTTATAGTGTGTTCAACTAAGAGTTAAGCAAAG
Sequence Type genomic DNA
Unitrap ID UNI29582

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 174012087..174012163 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003458 (Ncstn) NM_021607 nicastrin Gene [Source:MGI (curated);Acc:Ncstn-001]

 
Come back to gene ENSMUSG00000003458


For any suggestions or comments, please send an email to unitrap@crg.es