Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E323B07
Clone ID E323B07
Vector rsFlipROSACeo0
Project ggtc

SPLK-Sequence tag 5SE323B07
Sequence
GATCGCTTCGGCCGGCACGTGGCGGGCGTGAGTGACCCGCGGTCAGCTCGCAGCCCGCTGCGTGGCTGTGGATAGCTGGT
GCGCCTCCGCTTGGGACTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE323B07
Sequence
ACAGGCGGGCATTAAGACTCCAGAGAAAAGATCGTGGAGAATAGGACGGCTGGTGCCCGGTGGCTGGGGCTCTGGGTCCT
GCGCGTCTTTGTTCCCAACCCCCATTACACATGCAGCTCGGGTCCCCTGCGGCCCGAGGTGGCAGCAGCGGGGAGTCTGG
GAAACCCGCGANNNGCGGGTCCCGGAGTGTAGGGAAGGGCTGGG
Sequence Type genomic DNA
Unitrap ID UNI22279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119312535..119312738 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061393 (Acvr2b) NM_007397 activin receptor IIB Gene [Source:MGI Symbol;Acc:MGI:87912]

 
Come back to gene ENSMUSG00000061393


For any suggestions or comments, please send an email to unitrap@crg.es