Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E140H12
Clone ID E140H12
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE140H12
Sequence
TGGATCCTACTGCAATCACTGCTGGCGNNNNNACGCAGGAAACGACCCGCCGGGGAATCCGCGCCCTGGCTGGGAGCGCA
GGGCCTTTTGCGGATTCTGGTCCAGTGGGGAACACGGTCCGACTGGAACTCGGGTCCCACAGGACTAAACTGGCCGAGCA
GGAAGCATCAGTCAGGGGCTGCATCGCGGAGCAGATGGCCTCGTCCACCGTGGAGAGTTTCGTGGCCCAGCAGCTACAGC
TGCTGGAGCTGGAGCGGGACGCCGAGGTGGAGGAGCGCAGGTAAGTTTGGCCGCAGGTCCCAGGCCCTCTGTAGCTCTCC
TTAGTTACCGCCTGGAGCCAGTCTAGTGTTGGCTGGGTGAATGGCTAACACACAGAGACAGCCCTAGGAGAAGACCGCAC
AGCAGCGTCACT
Sequence Type genomic DNA
Unitrap ID UNI29595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3282569..3282980 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024831 (Ighmbp2) NM_009212 immunoglobulin mu binding protein 2 Gene [Source:MGI (curated);Acc:Ighmbp2-001]

 
Come back to gene ENSMUSG00000024831


For any suggestions or comments, please send an email to unitrap@crg.es