Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E140F08
Clone ID E140F08
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE140F08
Sequence
GATCCAGTTTTCGCTATGGCCCTAGATGTTTGTGGACCAT
Sequence Type genomic DNA
Unitrap ID UNI27420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101433681..101433720 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]


SPLK-Sequence tag 3SE140F08
Sequence
CCATGCAGAGTCATTGCATCAGTGCCCGGGTCTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es