Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E140B02
Clone ID E140B02
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE140B02
Sequence
GGACTCGAGGGTGTGCAGAGATTTTATCCTAGTCCTGGGATCGTGGGTGCCCTGGTACCTCATCAGCGTGTGGCGCTCCG
GCAGGCGCCATGCGGCGGGCAGGGTTGTCGTACCCACGCTTTGCCAGGCTTNNNTTGCGGTCTGTGGATTGTTTTCNNNA
TGCTCAGCGGCATCCTAACGTTTCCAGGTAAGAGTCTGGGAAGGAGGCACAGGCCAGAAGGACAGCTCAGTT
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25698347..25698578 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


SPLK-Sequence tag 3SE140B02
Sequence
TACCATAGGCAGGTGACACCATTCCTGTTGCATGATGTGTATGACCCAAGGCTGGGTCACATTTTGAGTCAATCAGATTT
AGAAGGGTGTACATATCGGTCTCTGCCTGCACTATGTAGCTTCTGCCCTTCATTCCCAGGTGCCCTGGTGCCCTCCTCTT
TAAATTTCCGGTGGCAAACATTTGCCCATGATTTATTTACCTTACGATGTTGTCTAGGTATTTTGCCATCTTATTTCAGA
CTGAAGAAAAATACTTTCTTCTTCTCTTTTTACACTTCCTAAGAG
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25698923..25699207 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es