Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E139E07
Clone ID E139E07
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE139E07
Sequence
CTTGCTTTTATTTCGTTTGGAAGTCAGCTAGGTAACCTAGTTTGCAATGCATTCAAAATTTGCTCTTTCATAAAATGTCC
TTTAAAGCCTCTGAACTTCTTGTATTCATCTTAAAGCCACAAATAAATAAAGTTATGCCACGGGTGCCTTCAAATTATGT
TTTGCCTCTTCCAAGGCAGTCTTCGGGTTTCCACATAATCCAGGCATACTTTCTTAACCTACCAGAAGTCCCTCCACTAT
TTTGGCCTAGCCCCTCAAATTAAACGCCCCATT
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66558229..66558501 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


SPLK-Sequence tag 3SE139E07
Sequence
CCTTGAGTTTGCATTCATCAAATAAGATTTTTATTTTTTTAATTGGTGAAAGGAAGTATGTTTAGTGCTACGCTACCTCC
AATACAAAGGTCAGTACCACGTAGGAG
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66558059..66558165 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es