Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E139E02
Clone ID E139E02
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE139E02
Sequence
GAGTACATCCAGCTAAAACCAAACCAGAACAGTAAAGACTTTATTTGTGGGGTGGTTTTCTAAAGCATCAGGGGAGACGT
AATGAGTTCTCGGATATTCTTAAGACACACAATTTAAAACATAAGTAAGCTTTATATTTAAGGA
Sequence Type genomic DNA
Unitrap ID UNI29607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21775970..21776113 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]


SPLK-Sequence tag 3SE139E02
Sequence
CACATCAAGCCCTAGAACTTAATTTAATTATAGAAAAATTAAACAGCTAGTGTATAACCACGTGTTTTATTTTCTCAGTA
ACATATACTTCCATGACACGTTTTTTTGTTTTTTTTTACTATTAATGGAACAATGTTGTTACATTATTAATTGAGGGCAT
GCTCCTATTTCCTTAGTTAAAG
Sequence Type genomic DNA
Unitrap ID UNI29607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21776199..21776380 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]

 
Come back to gene ENSMUSG00000028248


For any suggestions or comments, please send an email to unitrap@crg.es