Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E139D02
Clone ID E139D02
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE139D02
Sequence
ATCCTGCCAGAGGGAGAATGGGACCAATTCATGGAGTCACTCCGAGAACCTCTCCCAGCCACACTGAGAATCACTGGGTA
CAAAAGGTACGTTTGCTGTGTCTTTTCTGAGGTGTGGACTTGGGGGCTGTAGTGCACAGGAACGTCCCCGGTGGGACATT
AGCTTTTGAATAGTAAGCCTGGTGTCGGCAATAGTGGGGTCCTATGGGTGACCATCAGAGCAGCAGGAATCTTCGCCTCT
CTTGCACGTCAAAGTACGTTGTCCGCAAGACTCGTGGCAATTAAAAACTGAAGCTGTGACAAAATGCAGTATTGCTTTTA
CCTTATTTGTAAGGTGTGTCCAACACAACAGTGAACTGGAGGGAGTTAGAAAATTGATGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE139D02
Sequence
TAGGTGTTAAAAAGTCTGCACACCCCGGACCGTTTATGGAACGTCTTCTCAGAACTGGTTTTACGTTTAAAACACTTGCA
ATCTTAAAGCTATTAAATCTTACCAACTCACCTTCTTAGATGACTGTGAAACTTGCT
Sequence Type genomic DNA
Unitrap ID UNI29608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69751659..69751796 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]

 
Come back to gene ENSMUSG00000021595


For any suggestions or comments, please send an email to unitrap@crg.es