Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E139B07
Clone ID E139B07
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE139B07
Sequence
ATTTTATTTCTAAGCGATTAAGATGGCTGAGTGTGCGGAACCCTTTCACGTCTCTGGCTAAGTTTTGTTGTTATTTCGAG
TTCTATCCTTAATACCTCTGTGAAGTGGATCATTCATTAACCATTCAAAACAAGTCAATTATTTAAAAAGGAGGCCCCAT
ATTTAAGAATCTTGGCAGG
Sequence Type genomic DNA
Unitrap ID UNI29610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165654302..165654480 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


SPLK-Sequence tag 3SE139B07
Sequence
GCAGGCGCCTNCCAGGCTAATTTGGTTTGCATTAAGAAAATTAAAAAAAAAAAAGTAACCTCCCTTGGAAATGGCTGAAG
CTGACCCAAAGTCTCTCTCTCTCTTTTGCCACCCAAGAGCCGGGGTCCCAGTCAAAAATTGCCACCCCATGTCTAAAAAA
ACCCCCTTTTCTGTGAAAAAAACTAAAAGTTTCTTCAACAGCCCCATGCAAAAAATGGAATTTTACGGGGAGAACATACG
GGGGAAGTTGGGGGTTTTTAATTACCCCCCGTTCAGGACGCCCTACCCGCCCAAAAACCAGTACCAAATGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es