Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GST093
Clone ID GST093
Vector pGT1.8TM
Project baygenomics

Sequence tag GST093
Sequence
ATCTATANCTACCTCAGTCAAACAGATGGANCAGGGGATTGGCGTGAAAAAAGAGGCCAAAGATCTGACAGAGCTGGTCC
AGCGGAGAATAACATATCTCCAGAATCCTAAGGACTGCAGCAAAGCCAGGAAGCTGGTGTGTAACATCAATAAAGGCTGT
GGCTATGGTTGTCAACTCCATCACGTGGTCTACTGTTTCATGATTGCTTATGGCACCCAGCGAACACTCATCTTGGAATC
TCAGAATTGGCGCTATGCTACTGGTGGATGGGAGACTGTGTTTAGACCTGTAAGTGAGACATGTACAGACAGATCTGGCC
TCTCCACTGGACACTGAAACCAAGAAG
Sequence Type mRNA
Unitrap ID UNI10237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78494724..78513931 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021065 (Fut8) NM_016893 fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]

 
Come back to gene ENSMUSG00000021065


For any suggestions or comments, please send an email to unitrap@crg.es