Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E139A07
Clone ID E139A07
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE139A07
Sequence
ACTCCGTGTTNNNTTCTGGCCACTCCCGCAGGCCCTCCCAGCTTTNGGTTCCGGAGAAACTGGTAGAGCCCCGCCCCTTC
CCGTCCTTCGCCCCCGTAGCCCAGGCGCGCCGGTGATCCTTGCGAAAATGCAGCGGGTGCGGGGCTCACAGATGAATGGG
AGAATGAGTGGCTGGCCCACAGTTTTATTCAATTACAGCATGAGCCAGCCTCTTGCTCACACTCCCAGCCTCTGAGATTC
ATTCATTCATGCAAGCGCTCACCAGTGGGTTATGGAATCTCCAGCAAGTGCCTAGCTGAGTGCTTGCCTAAGACCGGAGC
AGTCTCCCGGCAGTCTGACAAGGAAGCAGACGATTAGTACTTAATTTAGTAAGGAGGAGGCTGTGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI29611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75465388..75465777 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017774 (Myo1c) NM_001080775 myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002]


SPLK-Sequence tag 3SE139A07
Sequence
AAATAAGAAGGCGCTATGGCTAATGTGATTCCTGAGCTGACTCTTCGGTGATGACTCAGTGAAGTGGGTAGACCGAGAGA
GCTGGTTTTAGTAAGCTGCAGGTGCTAAGCCACAGCACGTTGCAGTCTCCCGTGGTTGGTGGTTGTCCGCAGGTGTACGA
CCAGCACCTCCTGGCTGTGTGTGGTAGTGAAGAAAGAAGGGACTGGAAAGGACTACCTGTTCAGTTAGAGATTAATCCAG
GAGTAGTGCAGTAAACTGAGCCCCTGGTCAAGCGTGAAGGGCAAGCTTGGCACCCGGNNGGCGGGGAGCGGTGCTTTCTA
AGCCTCCTTTCCATTAACTTGAGATGGTAACAGTGTTAGAGTCGCATTTGTAATTGCCAGAGCGCAGAACCGAAGAAGGC
TGTTACTTTGTTCCAGGAGAGCTGCAGGATGTAGAAGCCGGAATGAGGTTTTAGCAGGTGGTGACTGATCTGATTGGTGT
AAGGGGAAGAGGACCAGCTTTGAATGCCAGCCAGGTCATGATTACCACAGCTAGAGATGCTGTCCCCCTCTCCGGGGAAG
ATGAGTGAATGTGAAAACTCATTTAGGGGCAAGGAGCTCTGTTTATTTTTGCTGGATTCTCCAGTAAAGATTCTGGCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017774


For any suggestions or comments, please send an email to unitrap@crg.es