Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E139A06
Clone ID E139A06
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE139A06
Sequence
AGGGCATCATTTTAAACATCAACCTTTATCCTCTACATGCATGTGCCTGTATGCAAACATACACATATACACAC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6058028..6058101 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


SPLK-Sequence tag 3SE139A06
Sequence
AATTGACCTGCTGAAACACGGATCGTGGAAAACCACAACTGTTGATACAAAGCTATAGAGAGAAACCCTGTCTTAGACTG
GAAAAGAGGCAAACAAAACCAAAACTTATTGAATGAAAGTTAGATGTAATACAAAAAACTATAGGAATTGGTTTTGTGTG
TGACAGAGGGTGGTGCTTGCATGGGCGTGGTTATCCATGCATGTGTGTGTTTGTTGATATTGGGTGTCCTTGATCTCTCT
TGTCCTTGATTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es