Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GST098
Clone ID GST098
Vector pGT1.8TM
Project baygenomics

Sequence tag GST098
Sequence
GTTCCTGAAAATCACCAGTTCTGTGCTTCATTATGTGGTGTGCTTCCCCGGCATTGACTGAAGGCTATGTGGGGACCCTG
CAGGAGAGCAGACAGGACAGCTCAGTGCAGATCCGCAGACGAAAGGCATCCGGAGACCCATACTGGCGTATAC
Sequence Type mRNA
Unitrap ID UNI10238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12386797..12553729 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es