Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E138G04
Clone ID E138G04
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE138G04
Sequence
GACCTGGTTAGAGTGGACAGTGATGGTCCCAGGGGTCAGGGGGCTCACCAGTGGGGTCCATTCCATGTGGCTGAGAATGC
ACCCCCCACACCTAAAATCATGTCTCTTCCCCCCAGATTATAATCACTAATGAGTACAGTAACTATACAAATATTTGCTC
TATTTACTGAAGGAGAGCAGTGTTGGAGTCTTGCCTGCGCCTTCTTCCTCTGGCTTAAAGTGAGCACTGGTTTATTTTAA
ATCTCACATGGTGACGCATTAATATTTGGTTCCCTTTGTGTGGCTCAGTTCATCACTTAGTTCCCTTTCTTGAAAGCAGC
GTTTGCAGAACAGACAGAAGAGTATTTCTCAATAGGGGAGAGAAACAAGGGCATCCATAAACTGAGGCAGAGGAAGCATC
AGGC
Sequence Type genomic DNA
Unitrap ID UNI27862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119600647..119601050 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]


SPLK-Sequence tag 3SE138G04
Sequence
CTTCCTAAGGCTTCTTCCAGGTAACACTATGGAAGGAGACTAGGAAGCATCTATCCAGCGCCTCGTCCATCCCGTGAGAC
AGTCGGGACAATTTAATGAGGCTCGGTCAGGATGAAGTAAAAAGAA
Sequence Type genomic DNA
Unitrap ID UNI27862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119600491..119600616 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]

 
Come back to gene ENSMUSG00000020227


For any suggestions or comments, please send an email to unitrap@crg.es