Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E138D10
Clone ID E138D10
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE138D10
Sequence
GATCTGGTGGGGTTCACACCTACGCGGATTGTTCTGAAGAACTTGTTTGCAGTGGCTCTGTTTAACGCACTTTTTTTCCC
CCTCCCCCTCTTTACCACCTCTGTCGTCTTGCTTCAGAGACCTAAAGGGCAAGGAAATAAAGGTGAGTTTGTTTGTTTGT
TTTCCCCTTAGGTGTTCCCTTGATGTGATTTTTTTTTAAAAAAAACTGTAAGCGGTTTCTTTCTTGTTTTTGCACTTCTT
TCTAAATATAAAGGATAGAAAAACATCCAACGCAGCTAACAGACAACATTTACTTAGCTCCTGGGTTTGTAGAAACCGAA
GTACTAAGAAGAAACAGCTGTCTTGGTTGTATTTCAATGAACGTAATGTTATTTCTTCAGTTTACCATTTATGTTTGTTA
CATAACT
Sequence Type genomic DNA
Unitrap ID UNI29617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16083805..16084211 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]


SPLK-Sequence tag 3SE138D10
Sequence
ACTTAGGTCATACTTTTTTCTACATATTGTGTATAGTTGGATAAGTTTTTAAAGTGAACAGCGTTCTGTTTGAAATTTCG
GGATTACATTTAAACTTGGCAAATCACATGGCGTTCTATGCCACATTGGGTGAAAATCATGCCCCAATCACTGAATAGAA
TCAGTGAAGTTGCTTGCAAGGAGACAACACCACTATAGAACTCCTAACAAGTATGTAATCTTACAGCAGCGCTCTGATTG
GAAGGCGTGTCTCGATCTGGTTTCTTACAAAAGCCCGAGAAGGAAATTATTTGTGCAGTTATTGCTAGTGTTATATGATT
TGCTATTTAAAAACTACCACTAAAAGTAAGGCAGTTAAAACACAAATGTAGTTTGTATTTATGCGTGTGGAACAAAGTAG
TCAGCTGATTGAAACATGGCTTAACATGTGATATTAGTGTAGAACAATAACTCCTTTCTTGGGGTGGTGCCAATTAAAGA
ACATTACAATGAGCTATATATTTGTAACGTTTTGTAGTGCCGGAAGTGACACTAAATACAATTACACTTCCTGCTTTTTT
TTTTCTTCCCCGTTCCCCAGTAACTAAGTACTACTTAAA
Sequence Type genomic DNA
Unitrap ID UNI29617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16084209..16084806 593
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

 
Come back to gene ENSMUSG00000047213


For any suggestions or comments, please send an email to unitrap@crg.es