Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GST107
Clone ID GST107
Vector pGT1.8TM
Project baygenomics

Sequence tag GST107
Sequence
TGGAGAGCTGCCTCCTGGCTCGAGACCCCTACTGCGCCTGGAACTGGCTCTGCTGCAGGCTCGCTAGCCTCTACCAGCTG
ACTGCTCTAGCATGACCAGACATGAGGTG
Sequence Type mRNA
Unitrap ID UNI10240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87365748..87365824 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es