Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E138D05
Clone ID E138D05
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE138D05
Sequence
GCGCGGTGGCAGCGCACCGCCTCCTGCCTTCCGGTTCACGCTTCAGGTTGCCTCACCGTTCTTTTACGCGGGGCGGGACT
TACTACATAACTGTTTCCGGGTTGTAGAGTGACCTTGAGCCCTCGAAAGCGACATGGCGGTTCTCTTAAAGCTGGGCGTT
CTCTGCAGTGGCCAAGGAGCTCGAGGTGAGGTGTCTTGGCCATCAAAGGTTCTTGCTGCAGGCTGGAGCAGGGGAGAGGA
AGGAGTTAGAGCTCGCCCGCTGGGTGGTGGGACGTCTTGAGAGGAGGGAACTTGCTCTTGTGCCCTTGAGGCACCACCTA
TGCGGACGCAACGTTGACCGCTATAGCCTAAAGGCCCAAGTGTTTACGTGCTGGCTGGTGTCCCCAGCTCGTACTTTCCG
CTTCTGCACTGTGGTTGTGACACCGGGCTAATGTGAAAACATACTTCTATTTGAGTGTGGATGGAAGGAGTCCGTTTGAT
AATTTGTTCTGAGTGG
Sequence Type genomic DNA
Unitrap ID UNI10901

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50411532..50412027 482
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000171 (Sdhd) NM_025848 succinate dehydrogenase complex, subunit D, integral membrane protein Gene [Source:MGI Symbol;Acc:MGI:1914175]


SPLK-Sequence tag 3SE138D05
Sequence
ACCGTGTACCCTCACTCAGNNGCTTCGTTAATCATTTTAACCAGGCATTTTACCTATCCCCGGCGCTTGAGAGGCTTGTA
TTTAAACACCAATTAAACAGTTTCNNCCCTCGAAGAACTTCTTGTGTGGGAGCTACAGGCAAAGTAAAGCAAAACCTGTT
GTGTTATGTAGACATTATTGAGTGCAGAGAAAGTTTGGGGTACTTGCTTTGAAAGGACTAACCTGCCTTGGCTCTGCAGG
GAATTACATCCTATAGTAACCGAGAGCAGCAAAAACCAAAGTGAGGCGCTATAAGGATGCTTCGGGTGCAATAAAATGGA
ACAAATACAGTAATATCTGTGAAAGTCAAAGTGTAATCTAGAAAGGCAAAATGGAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000171


For any suggestions or comments, please send an email to unitrap@crg.es