Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E138C04
Clone ID E138C04
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE138C04
Sequence
AAATGTAAATATGTTGGTAACTTGGTTGATGGCCAATCTGTCCTAATCTATCCTTAGGTTATTTAGTTTTTTTATATGCC
TCATGTAGTGTGATACTAAATTTCTGTTTGCTAGAAAATATTAATGTTTTTAGTGTGGGTTGTTAATCACAGGATA
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95169366..95169521 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es