Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E138C03
Clone ID E138C03
Vector rFROSAbgeo+2s
Project ggtc

SPLK-Sequence tag 5SE138C03
Sequence
GATCTCTATAGTTTGAGGTACTCATGGCTGATATGCTGGGGTGTCCTGACTCAAAAAGAAGAAGAAAATGTAAGTTCTTG
C
Sequence Type genomic DNA
Unitrap ID UNI17568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95169672..95169752 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


SPLK-Sequence tag 3SE138C03
Sequence
GCCGCGANNCCATGAGTTCAGTCCGTCGTCTGTCCCGCTCCCTTTTCCTGCCAAAGATAGTAGGACTGAGTTTGAGGAGT
TGTGGTGAATTCAGCAAGTACTCTTTGTCCAGCTTAGAAAAGAGCACGTGTCAGTGCTTACTAGGTAACGTAATCTTCAT
GGCTCATCACCCTTCCAGAGGCCGAGAGTTATGGCTAGGGTGTGGCATGCGTTTTTCTGAGAACCCGCCAGGGTCGGCAG
CAGGGACTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es